Types of Neural Network
| Speech Recognition |  |
\(\longrightarrow\) | Get your facts first, then you can distort them as you please. |
| Music generation | \(\emptyset\) | \(\longrightarrow\) |  |
| Sentiment classification | Great movie ? Are you kidding me ! Not worth the money. | \(\longrightarrow\) |  |
| DNA sequence analysis | ACGGGGCCTACTGTCAACTG | \(\longrightarrow\) | AC GGGGCCTACTG TCAACTG |
| Machine translation | 网红脸 | \(\longrightarrow\) | Internet celebrity face |
| Video activity recognition |  |
\(\longrightarrow\) | Running |
| Name entity recognition | Use Netlify and Hugo. | \(\longrightarrow\) | Use Netlify and Hugo. |